2(013)

Product Information

Cingolani, F. et al. Inhibition of dihydroceramide desaturase activity by the sphingosine kinase inhibitor SKI II. J. Lipid. Res. 55, 1711–1720. https://doi.org/10.1194/jlr.M049759 (2014). Ogretmen, B. Sphingolipid metabolism in cancer signalling and therapy. Nat. Rev. Cancer 18, 33–50. https://doi.org/10.1038/nrc.2017.96 (2018).

Powell, J. A. et al. Kelch-like protein 5-mediated ubiquitination of lysine 183 promotes proteasomal degradation of sphingosine kinase 1. Biochem. J. 476, 3211–3226. https://doi.org/10.1042/BCJ20190245 (2019). McNaughton, M., Pitman, M., Pitson, S. M., Pyne, N. J. & Pyne, S. Proteasomal degradation of sphingosine kinase 1 and inhibition of dihydroceramide desaturase by the sphingosine kinase inhibitors, SKi or ABC294640, induces growth arrest in androgen-independent LNCaP-AI prostate cancer cells. Oncotarget 7, 16663–16675. https://doi.org/10.18632/oncotarget.7693 (2016).Newton, J., Lima, S., Maceyka, M. & Spiegel, S. Revisiting the sphingolipid rheostat: Evolving concepts in cancer therapy. Exp. Cell Res. 333, 195–200. https://doi.org/10.1016/j.yexcr.2015.02.025 (2015).

Salomone, S. & Waeber, C. Selectivity and specificity of sphingosine-1-phosphate receptor ligands: Caveats and critical thinking in characterizing receptor-mediated effects. Front. Pharmacol. 2, 9. https://doi.org/10.3389/fphar.2011.00009 (2011). Long, J. S. et al. Sphingosine 1-phosphate receptor 4 uses HER2 (ERBB2) to regulate extracellular signal regulated kinase-1/2 in MDA-MB-453 breast cancer cells. J. Biol. Chem. 285, 35957–35966. https://doi.org/10.1074/jbc.M110.117945 (2010). Song, J. H., Kim, G. T., Park, K. H., Park, W. J. & Park, T. S. Bioactive sphingolipids as major regulators of coronary artery disease. Biomol. Ther. 29, 373–383. https://doi.org/10.4062/biomolther.2020.218 (2021). Powell, J. A. et al. Targeting sphingosine kinase 1 induces MCL1-dependent cell death in acute myeloid leukemia. Blood 129, 771–782. https://doi.org/10.1182/blood-2016-06-720433 (2017). Wang, Z. et al. Molecular basis of sphingosine kinase 1 substrate recognition and catalysis. Structure 21, 798–809. https://doi.org/10.1016/j.str.2013.02.025 (2013).Pitman, M. R., Pham, D. H. & Pitson, S. M. Isoform-selective assays for sphingosine kinase activity. Methods Mol. Biol. 874, 21–31. https://doi.org/10.1007/978-1-61779-800-9_2 (2012). Park, S. J. & Im, D. S. Deficiency of sphingosine-1-phosphate receptor 2 (S1P2) attenuates bleomycin-induced pulmonary fibrosis. Biomol. Ther. 27, 318–326. https://doi.org/10.4062/biomolther.2018.131 (2019). Bonhoure, E. et al. Overcoming MDR-associated chemoresistance in HL-60 acute myeloid leukemia cells by targeting sphingosine kinase-1. Leukemia 20, 95–102. https://doi.org/10.1038/sj.leu.2404023 (2006). Human S1P lyase cDNA (SGPL1, Genbank Accession number NM_003901) was amplified from placenta cDNA and FLAG epitope-tagged at the 3′ end by PCR with oligonucleotide primers 5′-TATATAGAATTCGCCACCATGCCTAGCACAGACCTTCT-3′ and 5′-TATATAGAATTCACTTGTCATCGTCGTCCTTGTAGTCGTGGGGTTTTGGAGAACCAT-3′. The PCR product was digested with EcoRI and cloned into pcDNA3 (Invitrogen) for expression in mammalian cells. Sequencing verified the orientation and integrity of the cDNA. Quantitative RT-PCR To generate doxycycline-inducible S1P 2 shRNA contructs the pTRIPz lentiviral vector was modified with the addition of a poly-linker as described previously 13. shRNA target sequences from Fellmann et al. 42, S1PR2 (5′ TGCTGTTGACAGTGAGCGCAAGGCACTGACTAGTCACATATAGTGAAGCCACAGATGTATATGTGACTAGTCAGTGCCTTATGCCTACTGCCTCGGA) and Renilla luciferase 713 negative control (5′ TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA). shRNA oligonucleotides were amplified using EcoRI MirE primers (5′ TAGAATTCTGCACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCG, 3′ TCTCGAATTCTAGCCCCTTGAAGTCCGAG-GCATAGGC). PCR products were digested with EcoRI and cloned into pTRIPZ. To generate lentivirus, HEK293T cells were co-transfected with this vector (or empty pTRIPZ) and pLP1 (gag/pol), pLP2 (rev), pTAT and pVSVG vectors using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. Two days after transfection the media was changed from DMEM (10% FBS) to RPMI (10% FBS) and incubated for a further two days. The viral supernatant was then added to 5 × 10 6 MV411 cells containing 4 µg/ml polybrene and incubated for an additional 72 h prior to selection with 1 µg/ml of puromycin. Doxycycline induced RFP expression confirmed transduction efficiencies of > 80%.

Schwab, S. R. et al. Lymphocyte sequestration through S1P lyase inhibition and disruption of S1P gradients. Science 309, 1735–1739. https://doi.org/10.1126/science.1113640 (2005). Using an internal standard approach, 58 sphingolipid species were identified based on accurate mass and retention time, with the majority of sphingolipids detected with excellent precision (RSD < 10%). Quantitation was performed by semi-automated peak integration using Tracefinder 3.2 (Thermo Fisher) with manual verification. The sample concentrations were calculated based on the ratio of peak area of each identified lipid component over the area of the corresponding internal standard (C17 ceramide was used as internal standard for all ceramides). Concentrations were then converted to pmol/1 × 10 6 cells by dividing calculated concentration by cell number. For simplicity of nomenclature, ceramides with no double bonds were defined as dihydroceramides, those with one double bond defined as ceramides, and those with two double bonds defined as ceramides with unsaturated N-linked acyl chains (noting that the latter two classes may contain small contributions from isomeric dihydroceramides with unsaturated N-linked acyl chains). Sphingosine kinase assaysChen, M. H. et al. Identification of SPHK1 as a therapeutic target and marker of poor prognosis in cholangiocarcinoma. Oncotarget 6, 23594–23608. https://doi.org/10.18632/oncotarget.4335 (2015). Saba, J. D. Fifty years of lyase and a moment of truth: Sphingosine phosphate lyase from discovery to disease. J. Lipid. Res. 60, 456–463. https://doi.org/10.1194/jlr.S091181 (2019). Li, C. et al. Sphingosine 1-phosphate receptor 2 antagonist JTE-013 increases the excitability of sensory neurons independently of the receptor. J. Neurophysiol. 108, 1473–1483. https://doi.org/10.1152/jn.00825.2011 (2012).

The publication of the Counter Fraud Functional Standard reinforces the government’s commitment to fighting fraud. By meeting the requirements of this standard, public bodies are better prepared, and more able to respond to the risk of fraud against the public sector. Purified Des1-FLAG protein was assayed with NBD-C6-dhCer in 1% fatty acid-free BSA, 1 mM NADPH, 50 µM (NH 4) 2Fe(SO 4) 2 (prepared with 3 × molar excess ascorbic acid) and recombinant cytochrome B5 (CYB5) in 50 mM Tris–HCl buffer (pH 7.2) with 1 mM DTT. The reaction was incubated at 37 °C for 30 min, and then terminated by the addition of methanol and centrifugation at 17,000× g for 5 min. Lipid extracts were transferred to glass HPLC vials and analysed as above. S1P lyase assayPyne, N. J. & Pyne, S. Selectivity and specificity of sphingosine 1-phosphate receptor ligands: “off-targets” or complex pharmacology?. Front. Pharmacol. 2, 26. https://doi.org/10.3389/fphar.2011.00026 (2011). Goodman, A. D., Anadani, N. & Gerwitz, L. Siponimod in the treatment of multiple sclerosis. Expert Opin. Investig. Drugs 28, 1051–1057. https://doi.org/10.1080/13543784.2019.1676725 (2019). The Counter Fraud Functional Standard was launched in October 2018, and is being implemented across government. It applies to all government departments and their arms-length bodies. As of February 2020, 123 public bodies had adopted the functional standard as the basis for managing the risk of fraud, bribery and corruption in the public sector. Brinkmann, V. et al. Fingolimod (FTY720): Discovery and development of an oral drug to treat multiple sclerosis. Nat. Rev. Drug Discov. 9, 883–897. https://doi.org/10.1038/nrd3248 (2010).