About this deal
Huang, J. (2017). "A reference human genome dataset of the BGISEQ-500 sequencer". GigaScience. 6 (5): 1–9. doi: 10.1093/gigascience/gix024. PMC 5467036. PMID 28379488. CTAGGCAACTATAGGTCTCAGTTAAGTCAAATAAAATTCACATCAAATTTTTACTCCCACCATCCCAACACTTTCCTGCCTGGCATATGCCGTGTCTGCC The Wilson Triad features a three-piece construction with discretionary weight having been moved from the core to the outer layers in an effort to create faster ball speeds and less spin with the driver, which is the ultimate recipe for more distance. The new approach to weight distribution, tagged by Wilson as Tri-Balance Construction, was also implemented to increase stability and therefore improve accuracy on all shots, including shots played from on and around the green. The biggest difference between the two balls is that the R model’s urethane cover is completely unpainted, which is a golf industry first. Wilson maintains that the unpainted ball produces a stronger ball flight on full shots, more friction and spin on short shots, and increased accuracy. In our testing, the first two claims were realized, with the ball flying as far as some of the best distance golf balls on the market. Improved accuracy, however, was difficult to discern.
DNA nanoball sequencing - Wikipedia DNA nanoball sequencing - Wikipedia
Play George Church, Ph.D., a Core Faculty member at the Wyss Institute and Professor of Genetics at Harvard Medical School, explains how fluorescent in situ sequencing could lead to new diagnostics that spot the earliest signs of disease, and how it could help reveal how neurons in the brain connect and function. Credit: Wyss Institute at Harvard University. a b Blanco, Luis; Bernad, Antonio; Lázaro, José M.; Martin, Gil; Garmendia, Cristina; Margarita, M; Salas (1989). "Highly efficient DNA synthesis by the phage phi 29 DNA polymerase. Symmetrical mode of DNA replication". The Journal of Biological Chemistry. 264 (15): 8935–40. doi: 10.1016/S0021-9258(18)81883-X. PMID 2498321. a b c d e f g h i j Drmanac, R.; Sparks, A. B.; Callow, M. J.; Halpern, A. L.; Burns, N. L.; Kermani, B. G.; Carnevali, P.; Nazarenko, I.; etal. (2009). "Human Genome Sequencing Using Unchained Base Reads on Self-Assembling DNA Nanoarrays". Science. 327 (5961): 78–81. Bibcode: 2010Sci...327...78D. doi: 10.1126/science.1181498. PMID 19892942. S2CID 17309571. The best premium golf balls come in alternative versions that spin slightly less for players who prefer a firmer feel or more control off the tee. We recommend you try both kinds of feel from various distances to find your preferred feel. The FISSEQ technology has been licensed to ReadCoor Inc., a start up company spun out of the Wyss Institute, which will commercialize it as a new generation sequencing platform, allowing researchers to perform high throughput RNA sequencing and obtain the cellular locations of multiple RNAs simultaneously in intact cell and tissue samples of their choice.
Fullwood, M. J.; Wei, C.-L.; Liu, E. T.; Ruan, Y. (2009). "Next-generation DNA sequencing of paired-end tags (PET) for transcriptome and genome analyses". Genome Research. 19 (4): 521–32. doi: 10.1101/gr.074906.107. PMC 3807531. PMID 19339662.
Ball: Squish, Stretch, and Squeeze This Giant Molecule Stress Ball: Squish, Stretch, and Squeeze This
DNA Sensory Balls are popular fidgets, stress-reducers and hand strengtheners for kids who love to squeeze.
Chrisey, L.; Lee, GU; O'Ferrall, CE (1996). "Covalent attachment of synthetic DNA to self-assembled monolayer films". Nucleic Acids Research. 24 (15): 3031–9. doi: 10.1093/nar/24.15.3031. PMC 146042. PMID 8760890. Porreca, Gregory J (2010). "Genome sequencing on nanoballs". Nature Biotechnology. 28 (1): 43–4. doi: 10.1038/nbt0110-43. PMID 20062041. S2CID 54557996. An updated reference human genome dataset of the BGISEQ-500 sequencer". GigaDB . Retrieved 22 March 2017. The main disadvantage of DNA nanoball sequencing is the short read length of the DNA sequences obtained with this method. [2] Short reads, especially for DNA high in DNA repeats, may map to two or more regions of the reference genome. A second disadvantage of this method is that multiple rounds of PCR have to be used. This can introduce PCR bias and possibly amplify contaminants in the template construction phase. [2] However, these disadvantages are common to all short-read sequencing platforms are not specific to DNA nanoballs.